Bitterness

[cj001f]

A surfeit of the good stuff Oly

[Dechristo]

That should make him hoppy; what a friend!

[catbirdseat]

i think the white stuff on the out side of my orange after i peal it is bitter

Naringenin, Muffy. It's good for you. It helps repair your DNA. DNA is like a set of directions. The words have to be spelled right, or they don't make sense. Naringenin fixes spelling mistakes in DNA. Edited August 16, 2006 by catbirdseat

[sk]

i think the white stuff on the out side of my orange after i peal it is bitter

Naringenin, Muffy. It's good for you. It helps repair your DNA. DNA has to be spelled right. Naringenin fixes spelling mistakes in DNA.

that doesn't make it taste any better umm bitter

[G-spotter]

that stuff is pith. it's what they make pith helmets out of. ;p

[Dechristo]

{quote]Naringenin

 

It's the fluffy stuff atop a Lemon Naringenin Pie.

[Fairweather]

atcggtaccctagcatcgtatagactagctagttagctcgatcgcgtagctcagctctctcagatcgcatcgctagcatcgatcagctagctacgat

atctagcgtagcatcgatgctagtagctacgatgctagcatcgatcgattagctagcatcgatcgatcgatcgatgctatgcatgctfuckyoucatbirdatcgc

atactgcgctacgatcgattatcggctagctacgatcgtagcatcgatgctacgtacgtagctagtagctacgatgctagctacgtagctacgatctagcatcgat

cgatcgatgcatgctagctacgatcgtacgtaggctcyou'readumbassatcgctacgatcgtacgatcgatcgatcgtacgatcgtactacgatgctagctag

[Dechristo]

only three billion more characters to go

[catbirdseat]

I note that he has some non-standard bases in his genetic code.

[Dechristo]

many have decided the same

[G-spotter]

That's the Universal Ribosome

[Dechristo]

Are in, eh?

[Mos_Chillin]

ribosomeone named Adam?

[Dechristo]

Even chances

[catbirdseat]

Speaking of bitterness, here's a story. There is a company in Yakima called Yakima Chief which uses supercritical CO2 to extract pure hop oils from the flowers. This stuff is super concentrated. It takes an itty bitty quantity of this stuff to brew beer.

 

We received a one ounce sample for testing in the lab. My friend Ward, for some reason, took a finger and wiped it over the surface of the yellowish paste and applied it to his tongue. You should have seen his face. He said it was the most intense bitter taste he'd ever experienced. It took hours before it went away.

[archenemy]

I always wondered what highly educated scientists do in their labs...

[DirtyHarry]

Then the penguin said, No its just ice cream!!!!

 

HAHAHAHAHAHAHAHAHAHHAHAHAHAHAH

[catbirdseat]

I always wondered what highly educated scientists do in their labs...

Well this guy was "old skewl".

[cj001f]

I always wondered what highly educated scientists do in their labs...

Their TA's.

[marylou]

You'd bitter not ask, you'll pith them off.

[cj001f]

You'd bitter not ask, you'll pith them off.

 

Alas fair one, I've donned my helmet.

[minx]

I always wondered what highly educated scientists do in their labs...

Their TA's.

 

[Alpinfox]

OH!

 

I've got a good "crazy old skool scientist" story.

 

A guy in my department (who happens to be somewhat famous in the climbing/mountaineering community as well) was once tasked with synthesizing and purifying some metabolites to a particular drug. Rather than synthesize the stuff conventionally using organic chemistry techniques, he decided to just take the drug personally, let his liver and kidneys make the metabolites, collect his own urine, and isolate the metabolites out of it.

 

Worked like a charm supposedly and with fringe benefits!

 

[Cobra_Commander]

I always wondered what highly educated scientists do in their labs...

Their TA's.

 

bullshit they just sit in the stockroom "beating the beaker"

[cj001f]

I always wondered what highly educated scientists do in their labs...

Their TA's.

 

bullshit they just sit in the stockroom "beating the beaker"

 

Tell that to the blonde with the marks from an optical table all over her back