cj001f Posted August 16, 2006 Share Posted August 16, 2006 A surfeit of the good stuff Oly Quote Link to comment Share on other sites More sharing options...
Dechristo Posted August 16, 2006 Share Posted August 16, 2006 That should make him hoppy; what a friend! Quote Link to comment Share on other sites More sharing options...
catbirdseat Posted August 16, 2006 Share Posted August 16, 2006 (edited) i think the white stuff on the out side of my orange after i peal it is bitter Naringenin, Muffy. It's good for you. It helps repair your DNA. DNA is like a set of directions. The words have to be spelled right, or they don't make sense. Naringenin fixes spelling mistakes in DNA. Edited August 16, 2006 by catbirdseat Quote Link to comment Share on other sites More sharing options...
sk Posted August 16, 2006 Share Posted August 16, 2006 i think the white stuff on the out side of my orange after i peal it is bitter Naringenin, Muffy. It's good for you. It helps repair your DNA. DNA has to be spelled right. Naringenin fixes spelling mistakes in DNA. that doesn't make it taste any better umm bitter Quote Link to comment Share on other sites More sharing options...
G-spotter Posted August 16, 2006 Share Posted August 16, 2006 that stuff is pith. it's what they make pith helmets out of. ;p Quote Link to comment Share on other sites More sharing options...
Dechristo Posted August 16, 2006 Share Posted August 16, 2006 {quote]Naringenin  It's the fluffy stuff atop a Lemon Naringenin Pie. Quote Link to comment Share on other sites More sharing options...
Fairweather Posted August 16, 2006 Share Posted August 16, 2006 atcggtaccctagcatcgtatagactagctagttagctcgatcgcgtagctcagctctctcagatcgcatcgctagcatcgatcagctagctacgat atctagcgtagcatcgatgctagtagctacgatgctagcatcgatcgattagctagcatcgatcgatcgatcgatgctatgcatgctfuckyoucatbirdatcgc atactgcgctacgatcgattatcggctagctacgatcgtagcatcgatgctacgtacgtagctagtagctacgatgctagctacgtagctacgatctagcatcgat cgatcgatgcatgctagctacgatcgtacgtaggctcyou'readumbassatcgctacgatcgtacgatcgatcgatcgtacgatcgtactacgatgctagctag Quote Link to comment Share on other sites More sharing options...
Dechristo Posted August 16, 2006 Share Posted August 16, 2006 only three billion more characters to go Quote Link to comment Share on other sites More sharing options...
catbirdseat Posted August 16, 2006 Share Posted August 16, 2006 I note that he has some non-standard bases in his genetic code. Quote Link to comment Share on other sites More sharing options...
Dechristo Posted August 16, 2006 Share Posted August 16, 2006 many have decided the same Quote Link to comment Share on other sites More sharing options...
G-spotter Posted August 16, 2006 Share Posted August 16, 2006 That's the Universal Ribosome Quote Link to comment Share on other sites More sharing options...
Dechristo Posted August 16, 2006 Share Posted August 16, 2006 Are in, eh? Quote Link to comment Share on other sites More sharing options...
Mos_Chillin Posted August 16, 2006 Share Posted August 16, 2006 ribosomeone named Adam? Quote Link to comment Share on other sites More sharing options...
Dechristo Posted August 16, 2006 Share Posted August 16, 2006 Even chances Quote Link to comment Share on other sites More sharing options...
catbirdseat Posted August 16, 2006 Share Posted August 16, 2006 Speaking of bitterness, here's a story. There is a company in Yakima called Yakima Chief which uses supercritical CO2 to extract pure hop oils from the flowers. This stuff is super concentrated. It takes an itty bitty quantity of this stuff to brew beer. Â We received a one ounce sample for testing in the lab. My friend Ward, for some reason, took a finger and wiped it over the surface of the yellowish paste and applied it to his tongue. You should have seen his face. He said it was the most intense bitter taste he'd ever experienced. It took hours before it went away. Quote Link to comment Share on other sites More sharing options...
archenemy Posted August 16, 2006 Share Posted August 16, 2006 I always wondered what highly educated scientists do in their labs... Quote Link to comment Share on other sites More sharing options...
DirtyHarry Posted August 16, 2006 Share Posted August 16, 2006 Then the penguin said, No its just ice cream!!!! Â HAHAHAHAHAHAHAHAHAHHAHAHAHAHAH Quote Link to comment Share on other sites More sharing options...
catbirdseat Posted August 16, 2006 Share Posted August 16, 2006 I always wondered what highly educated scientists do in their labs... Well this guy was "old skewl". Quote Link to comment Share on other sites More sharing options...
cj001f Posted August 16, 2006 Share Posted August 16, 2006 I always wondered what highly educated scientists do in their labs... Their TA's. Quote Link to comment Share on other sites More sharing options...
marylou Posted August 16, 2006 Share Posted August 16, 2006 You'd bitter not ask, you'll pith them off. Quote Link to comment Share on other sites More sharing options...
cj001f Posted August 16, 2006 Share Posted August 16, 2006 You'd bitter not ask, you'll pith them off. Â Alas fair one, I've donned my helmet. Quote Link to comment Share on other sites More sharing options...
minx Posted August 16, 2006 Share Posted August 16, 2006 I always wondered what highly educated scientists do in their labs... Their TA's. Â Quote Link to comment Share on other sites More sharing options...
Alpinfox Posted August 16, 2006 Share Posted August 16, 2006 OH! Â I've got a good "crazy old skool scientist" story. Â A guy in my department (who happens to be somewhat famous in the climbing/mountaineering community as well) was once tasked with synthesizing and purifying some metabolites to a particular drug. Rather than synthesize the stuff conventionally using organic chemistry techniques, he decided to just take the drug personally, let his liver and kidneys make the metabolites, collect his own urine, and isolate the metabolites out of it. Â Worked like a charm supposedly and with fringe benefits! Â Quote Link to comment Share on other sites More sharing options...
Cobra_Commander Posted August 16, 2006 Share Posted August 16, 2006 I always wondered what highly educated scientists do in their labs... Their TA's. Â bullshit they just sit in the stockroom "beating the beaker" Quote Link to comment Share on other sites More sharing options...
cj001f Posted August 16, 2006 Share Posted August 16, 2006 I always wondered what highly educated scientists do in their labs... Their TA's. Â bullshit they just sit in the stockroom "beating the beaker" Â Tell that to the blonde with the marks from an optical table all over her back Quote Link to comment Share on other sites More sharing options...
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.